You are currently viewing an outdated version of
SubtiWiki.
Please use
the newest version!
ydeD [2019-08-28 10:07:40]
Genomic Context
categories
[category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins][category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]Gene
Coordinates
562,502 563,461
The protein
Protein family
[SW|EamA transporter family] (according to UniProt)[SW|Domains]
[SW|EamA domain] 1 (aa 18-149) (according to UniProt)[SW|EamA domain] 2 (aa 171-296) (according to UniProt)[SW|Localization]
cell membrane (according to UniProt)Biological materials
Mutant
MGNA-C080 (ydeD::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2078 NBRP B. subtilis, Japan]BKE05160 ([gene|3BD05DE3ED5B293980F47EB621C54C7339F78DC7|ydeD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE05160 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACATGACTCCTCACTAA, downstream forward: _UP4_TAGGGGCTTTTTTTGCTTACBKK05160 ([gene|3BD05DE3ED5B293980F47EB621C54C7339F78DC7|ydeD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK05160 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACATGACTCCTCACTAA, downstream forward: _UP4_TAGGGGCTTTTTTTGCTTAC